Review



ultrascripttm cdna synthesis kit  (PCR Biosystems Ltd)


Bioz Verified Symbol PCR Biosystems Ltd is a verified supplier
Bioz Manufacturer Symbol PCR Biosystems Ltd manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95

    Structured Review

    PCR Biosystems Ltd ultrascripttm cdna synthesis kit
    Ultrascripttm Cdna Synthesis Kit, supplied by PCR Biosystems Ltd, used in various techniques. Bioz Stars score: 95/100, based on 370 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ultrascripttm+cdna+synthesis+kit/UltraScript+cDNA+Synthesis+Kit/bio_rxiv__64898__2026__03__05__708972-72-15-19
    Average 95 stars, based on 370 article reviews
    ultrascripttm cdna synthesis kit - by Bioz Stars, 2026-09
    95/100 stars

    Images

    Related Articles

    Gene Expression:

    Article Title: Tissue-Specific Experimental Evolution Reveals Adaptive Trade-Offs in the Plant Vascular Pathogen Clavibacter michiganensis
    Article Snippet: .. For gene expression, total RNA was extracted from culture supernatants using the Hybrid-R Kit (GeneAll), reverse transcribed with the UltraScriptTM cDNA Synthesis Kit (PCR Biosystems), and amplified using Fast SYBR qPCR Master Mix (Biogate) on a QuantStudio 3 system (Applied Biosystems) with gene-specific primers (Table S3). ..

    Reverse Transcription:

    Article Title: Tissue-Specific Experimental Evolution Reveals Adaptive Trade-Offs in the Plant Vascular Pathogen Clavibacter michiganensis
    Article Snippet: .. For gene expression, total RNA was extracted from culture supernatants using the Hybrid-R Kit (GeneAll), reverse transcribed with the UltraScriptTM cDNA Synthesis Kit (PCR Biosystems), and amplified using Fast SYBR qPCR Master Mix (Biogate) on a QuantStudio 3 system (Applied Biosystems) with gene-specific primers (Table S3). ..

    Article Title: Temporal dynamics of chicken host’s molecular response against Fowl adenovirus serotype 8b infection via RNA-sequencing
    Article Snippet: .. The total RNA retrieved during extraction of the infected liver was primarily subjected to conversion into cDNA synthesis via Reverse-transcriptase enzyme-based protocol, using the UltraScriptTM cDNA Synthesis Kit (PCR Biosystems, UK) following the manufacturer's provided guideline. .. All reactions were then synthesized in a Bio-RAD® Thermocycler with the temperature setting as follows: 42oC for 30 min (incubation), followed by 85oC for 10 min (Reverse transcriptase enzyme denaturation) and resting at 4oC prior to storage for further application.

    Article Title: Decanoic acid extends lifespan and modulates metabolism in drosophila models of PLA2G6-associated neurodegeneration.
    Article Snippet: .. RNA was reverse transcribed with the UltraScriptTM cDNA Synthesis Kit (PCR BioSystems) according to the manufacturer’s protocol. qPCR was performed on cDNA using the GoTaq® qPCR System (Promega) and Rotor-Gene Q (Qiagen). qPCR of iPLA2-VIA mutants (Fig. 1) was carried out in triplicate on cDNA from a single RNA extraction from 12 flies (three technical replicates). ..

    Article Title: Antimicrobial Mode of Action: Combined Essential Oils Extracted from Citrus meyeri, Citrus paradise and Citrus sinensis Leaves
    Article Snippet: Naturally derived compounds are powerful tools for controlling microbial infections.. However, the use of these compounds to control microorganism gene expression and growth highlights a new approach to fighting against microbial infections.. The current study aims to investigate the antimicrobial mode of action of combined essential oils (EOs) from Citrus meyeri, Citrus paradise and Citrus sinensis leaves by examining their effects on biofilm formation, cell membrane permeability, and bacterial lysis-related gene expression.

    Article Title: Low protein diet protects the liver from Salmonella Typhimurium-mediated injury by modulating the mTOR/autophagy axis in macrophages.
    Article Snippet: RNA from cells was isolated using the ReliaPrep RNA Miniprep System (Promega) according to manufacturer’s instructions and RNA quality was checked using a NanoDrop spectrophotometer (Thermo Scientific). .. RNA was reverse transcribed using UltraScriptTM cDNA Synthesis Kit (PCR Biosystems) according to manufacturer’s instructions, with a total reaction volumeof 10 ul, and aThermocycler (Bio-Rad).A pre-defined programwas run which consisted of 42 °C incubation for 30min followed by an 85 °C incubation for 10min. .. The reaction was held for 4 °C until samples were stored at−20 °C. qRT-PCR was then performed using qPCRBIO SyGreen Mix (PCR Biosystems), according to manufacturer’s instructions and a 5 ul total reaction volume in a clear 384Well StyleOptical qPCRPlate (Scientific Laboratory Supplies), sealed with FisherbrandTMAdhesive Plate Seals (Fisher Scientific), and run on the QuantStudio 7Flex Real-Time PCR System (Applied BioSystems) using a pre-defined method of a 3min hold stage at 95°C, aPCR stage consisting of 35 cycles of 15 s at 95°C, followedby1min at 60 °C, and then amelt-curve stage of 95 °C for 15 s, 60 °C for 1min, and then 95 °C for another 15 s. The following primers were used: Tbp1 (forward: GAAGCTGCGGTACATTCCAG; Reverse: CCTTGTACCCTTCACCAAT) Interleukin-1β (QuantiTect Primer Assay Qiagen, GeneGlobe ID - QT01048355), HIF-1α (Forward: TCATCAGTTGCCACTTCCCC.

    cDNA Synthesis:

    Article Title: Tissue-Specific Experimental Evolution Reveals Adaptive Trade-Offs in the Plant Vascular Pathogen Clavibacter michiganensis
    Article Snippet: .. For gene expression, total RNA was extracted from culture supernatants using the Hybrid-R Kit (GeneAll), reverse transcribed with the UltraScriptTM cDNA Synthesis Kit (PCR Biosystems), and amplified using Fast SYBR qPCR Master Mix (Biogate) on a QuantStudio 3 system (Applied Biosystems) with gene-specific primers (Table S3). ..

    Article Title: Temporal dynamics of chicken host’s molecular response against Fowl adenovirus serotype 8b infection via RNA-sequencing
    Article Snippet: .. The total RNA retrieved during extraction of the infected liver was primarily subjected to conversion into cDNA synthesis via Reverse-transcriptase enzyme-based protocol, using the UltraScriptTM cDNA Synthesis Kit (PCR Biosystems, UK) following the manufacturer's provided guideline. .. All reactions were then synthesized in a Bio-RAD® Thermocycler with the temperature setting as follows: 42oC for 30 min (incubation), followed by 85oC for 10 min (Reverse transcriptase enzyme denaturation) and resting at 4oC prior to storage for further application.

    Article Title: Decanoic acid extends lifespan and modulates metabolism in drosophila models of PLA2G6-associated neurodegeneration.
    Article Snippet: .. RNA was reverse transcribed with the UltraScriptTM cDNA Synthesis Kit (PCR BioSystems) according to the manufacturer’s protocol. qPCR was performed on cDNA using the GoTaq® qPCR System (Promega) and Rotor-Gene Q (Qiagen). qPCR of iPLA2-VIA mutants (Fig. 1) was carried out in triplicate on cDNA from a single RNA extraction from 12 flies (three technical replicates). ..

    Article Title: Ethylene biosynthesis in guard cells, not mesophyll, predominantly drives stomatal conductance responses to CO 2
    Article Snippet: Total RNA was extracted using the plant total RNA purification kit (Norgen Biotek Corp, Canada) following the manufacturer’s instructions. .. First-strand cDNA was synthesized from ⁓400 ng of total RNA for real-time PCR analysis using UltraScriptTM cDNA Synthesis Kit (PCR Biosystems, UK). .. Real-time PCR was performed using the Applied BiosystemsTM StepOneTM Real-Time PCR System (Applied Biosystems) with SYBRTM Green PCR Master Mix (Applied Biosystems) in the amplification mixture according to the manufacturer’s protocols.

    Article Title: A ciliopathy combining Joubert syndrome and Oro-Facial-Digital syndrome caused by bi-allelic 5'-UTR loss-of-function CEP83 variant.
    Article Snippet: Reverse transcription and real-time quantitative PCR Total RNAwas extracted from cultured fibroblasts usingGENzolTMTri RNA Pure Kit (Geneaid Biotech Ltd.). .. Single-stranded cDNA libraries were prepared using UltraScriptTM cDNA Synthesis Kit (PCR Biosystems Ltd.). ..

    Article Title: Antimicrobial Mode of Action: Combined Essential Oils Extracted from Citrus meyeri, Citrus paradise and Citrus sinensis Leaves
    Article Snippet: Naturally derived compounds are powerful tools for controlling microbial infections.. However, the use of these compounds to control microorganism gene expression and growth highlights a new approach to fighting against microbial infections.. The current study aims to investigate the antimicrobial mode of action of combined essential oils (EOs) from Citrus meyeri, Citrus paradise and Citrus sinensis leaves by examining their effects on biofilm formation, cell membrane permeability, and bacterial lysis-related gene expression.

    Article Title: Low protein diet protects the liver from Salmonella Typhimurium-mediated injury by modulating the mTOR/autophagy axis in macrophages.
    Article Snippet: RNA from cells was isolated using the ReliaPrep RNA Miniprep System (Promega) according to manufacturer’s instructions and RNA quality was checked using a NanoDrop spectrophotometer (Thermo Scientific). .. RNA was reverse transcribed using UltraScriptTM cDNA Synthesis Kit (PCR Biosystems) according to manufacturer’s instructions, with a total reaction volumeof 10 ul, and aThermocycler (Bio-Rad).A pre-defined programwas run which consisted of 42 °C incubation for 30min followed by an 85 °C incubation for 10min. .. The reaction was held for 4 °C until samples were stored at−20 °C. qRT-PCR was then performed using qPCRBIO SyGreen Mix (PCR Biosystems), according to manufacturer’s instructions and a 5 ul total reaction volume in a clear 384Well StyleOptical qPCRPlate (Scientific Laboratory Supplies), sealed with FisherbrandTMAdhesive Plate Seals (Fisher Scientific), and run on the QuantStudio 7Flex Real-Time PCR System (Applied BioSystems) using a pre-defined method of a 3min hold stage at 95°C, aPCR stage consisting of 35 cycles of 15 s at 95°C, followedby1min at 60 °C, and then amelt-curve stage of 95 °C for 15 s, 60 °C for 1min, and then 95 °C for another 15 s. The following primers were used: Tbp1 (forward: GAAGCTGCGGTACATTCCAG; Reverse: CCTTGTACCCTTCACCAAT) Interleukin-1β (QuantiTect Primer Assay Qiagen, GeneGlobe ID - QT01048355), HIF-1α (Forward: TCATCAGTTGCCACTTCCCC.

    Article Title: A ciliopathy combining Joubert syndrome and Oro-Facial-Digital syndrome caused by bi-allelic 5’-UTR loss-of-function CEP83 variant
    Article Snippet: Total RNA was extracted from cultured fibroblasts using GENzolTM Tri RNA Pure Kit (Geneaid Biotech Ltd.). .. Single-stranded cDNA libraries were prepared using UltraScriptTM cDNA Synthesis Kit (PCR Biosystems Ltd.). ..

    Amplification:

    Article Title: Tissue-Specific Experimental Evolution Reveals Adaptive Trade-Offs in the Plant Vascular Pathogen Clavibacter michiganensis
    Article Snippet: .. For gene expression, total RNA was extracted from culture supernatants using the Hybrid-R Kit (GeneAll), reverse transcribed with the UltraScriptTM cDNA Synthesis Kit (PCR Biosystems), and amplified using Fast SYBR qPCR Master Mix (Biogate) on a QuantStudio 3 system (Applied Biosystems) with gene-specific primers (Table S3). ..

    Real-time Polymerase Chain Reaction:

    Article Title: Tissue-Specific Experimental Evolution Reveals Adaptive Trade-Offs in the Plant Vascular Pathogen Clavibacter michiganensis
    Article Snippet: .. For gene expression, total RNA was extracted from culture supernatants using the Hybrid-R Kit (GeneAll), reverse transcribed with the UltraScriptTM cDNA Synthesis Kit (PCR Biosystems), and amplified using Fast SYBR qPCR Master Mix (Biogate) on a QuantStudio 3 system (Applied Biosystems) with gene-specific primers (Table S3). ..

    Article Title: Decanoic acid extends lifespan and modulates metabolism in drosophila models of PLA2G6-associated neurodegeneration.
    Article Snippet: .. RNA was reverse transcribed with the UltraScriptTM cDNA Synthesis Kit (PCR BioSystems) according to the manufacturer’s protocol. qPCR was performed on cDNA using the GoTaq® qPCR System (Promega) and Rotor-Gene Q (Qiagen). qPCR of iPLA2-VIA mutants (Fig. 1) was carried out in triplicate on cDNA from a single RNA extraction from 12 flies (three technical replicates). ..

    Article Title: Ethylene biosynthesis in guard cells, not mesophyll, predominantly drives stomatal conductance responses to CO 2
    Article Snippet: Total RNA was extracted using the plant total RNA purification kit (Norgen Biotek Corp, Canada) following the manufacturer’s instructions. .. First-strand cDNA was synthesized from ⁓400 ng of total RNA for real-time PCR analysis using UltraScriptTM cDNA Synthesis Kit (PCR Biosystems, UK). .. Real-time PCR was performed using the Applied BiosystemsTM StepOneTM Real-Time PCR System (Applied Biosystems) with SYBRTM Green PCR Master Mix (Applied Biosystems) in the amplification mixture according to the manufacturer’s protocols.

    Extraction:

    Article Title: Temporal dynamics of chicken host’s molecular response against Fowl adenovirus serotype 8b infection via RNA-sequencing
    Article Snippet: .. The total RNA retrieved during extraction of the infected liver was primarily subjected to conversion into cDNA synthesis via Reverse-transcriptase enzyme-based protocol, using the UltraScriptTM cDNA Synthesis Kit (PCR Biosystems, UK) following the manufacturer's provided guideline. .. All reactions were then synthesized in a Bio-RAD® Thermocycler with the temperature setting as follows: 42oC for 30 min (incubation), followed by 85oC for 10 min (Reverse transcriptase enzyme denaturation) and resting at 4oC prior to storage for further application.

    Infection:

    Article Title: Temporal dynamics of chicken host’s molecular response against Fowl adenovirus serotype 8b infection via RNA-sequencing
    Article Snippet: .. The total RNA retrieved during extraction of the infected liver was primarily subjected to conversion into cDNA synthesis via Reverse-transcriptase enzyme-based protocol, using the UltraScriptTM cDNA Synthesis Kit (PCR Biosystems, UK) following the manufacturer's provided guideline. .. All reactions were then synthesized in a Bio-RAD® Thermocycler with the temperature setting as follows: 42oC for 30 min (incubation), followed by 85oC for 10 min (Reverse transcriptase enzyme denaturation) and resting at 4oC prior to storage for further application.

    RNA Extraction:

    Article Title: Decanoic acid extends lifespan and modulates metabolism in drosophila models of PLA2G6-associated neurodegeneration.
    Article Snippet: .. RNA was reverse transcribed with the UltraScriptTM cDNA Synthesis Kit (PCR BioSystems) according to the manufacturer’s protocol. qPCR was performed on cDNA using the GoTaq® qPCR System (Promega) and Rotor-Gene Q (Qiagen). qPCR of iPLA2-VIA mutants (Fig. 1) was carried out in triplicate on cDNA from a single RNA extraction from 12 flies (three technical replicates). ..

    Synthesized:

    Article Title: Ethylene biosynthesis in guard cells, not mesophyll, predominantly drives stomatal conductance responses to CO 2
    Article Snippet: Total RNA was extracted using the plant total RNA purification kit (Norgen Biotek Corp, Canada) following the manufacturer’s instructions. .. First-strand cDNA was synthesized from ⁓400 ng of total RNA for real-time PCR analysis using UltraScriptTM cDNA Synthesis Kit (PCR Biosystems, UK). .. Real-time PCR was performed using the Applied BiosystemsTM StepOneTM Real-Time PCR System (Applied Biosystems) with SYBRTM Green PCR Master Mix (Applied Biosystems) in the amplification mixture according to the manufacturer’s protocols.

    Incubation:

    Article Title: Low protein diet protects the liver from Salmonella Typhimurium-mediated injury by modulating the mTOR/autophagy axis in macrophages.
    Article Snippet: RNA from cells was isolated using the ReliaPrep RNA Miniprep System (Promega) according to manufacturer’s instructions and RNA quality was checked using a NanoDrop spectrophotometer (Thermo Scientific). .. RNA was reverse transcribed using UltraScriptTM cDNA Synthesis Kit (PCR Biosystems) according to manufacturer’s instructions, with a total reaction volumeof 10 ul, and aThermocycler (Bio-Rad).A pre-defined programwas run which consisted of 42 °C incubation for 30min followed by an 85 °C incubation for 10min. .. The reaction was held for 4 °C until samples were stored at−20 °C. qRT-PCR was then performed using qPCRBIO SyGreen Mix (PCR Biosystems), according to manufacturer’s instructions and a 5 ul total reaction volume in a clear 384Well StyleOptical qPCRPlate (Scientific Laboratory Supplies), sealed with FisherbrandTMAdhesive Plate Seals (Fisher Scientific), and run on the QuantStudio 7Flex Real-Time PCR System (Applied BioSystems) using a pre-defined method of a 3min hold stage at 95°C, aPCR stage consisting of 35 cycles of 15 s at 95°C, followedby1min at 60 °C, and then amelt-curve stage of 95 °C for 15 s, 60 °C for 1min, and then 95 °C for another 15 s. The following primers were used: Tbp1 (forward: GAAGCTGCGGTACATTCCAG; Reverse: CCTTGTACCCTTCACCAAT) Interleukin-1β (QuantiTect Primer Assay Qiagen, GeneGlobe ID - QT01048355), HIF-1α (Forward: TCATCAGTTGCCACTTCCCC.



    Similar Products

    95
    PCR Biosystems Ltd ultrascripttm cdna synthesis kit
    Ultrascripttm Cdna Synthesis Kit, supplied by PCR Biosystems Ltd, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ultrascripttm+cdna+synthesis+kit/UltraScript+cDNA+Synthesis+Kit/bio_rxiv__64898__2026__03__05__708972-72-15-19
    Average 95 stars, based on 1 article reviews
    ultrascripttm cdna synthesis kit - by Bioz Stars, 2026-09
    95/100 stars
      Buy from Supplier

    95
    PCR Biosystems Ltd ultrascripttm cdna synthesis kit pcrbiosystems cat
    Ultrascripttm Cdna Synthesis Kit Pcrbiosystems Cat, supplied by PCR Biosystems Ltd, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ultrascripttm+cdna+synthesis+kit/UltraScript+Reverse+Transcriptase/pm38795709-758-173-177
    Average 95 stars, based on 1 article reviews
    ultrascripttm cdna synthesis kit pcrbiosystems cat - by Bioz Stars, 2026-09
    95/100 stars
      Buy from Supplier

    Image Search Results